TRANSLATE THIS ARTICLE
Integral World: Exploring Theories of Everything
An independent forum for a critical discussion of the integral philosophy of Ken Wilber
Ken Wilber: Thought as Passion, SUNY 2003Frank Visser, graduated as a psychologist of culture and religion, founded IntegralWorld in 1997. He worked as production manager for various publishing houses and as service manager for various internet companies and lives in Amsterdam. Books: Ken Wilber: Thought as Passion (SUNY, 2003), and The Corona Conspiracy: Combatting Disinformation about the Coronavirus (Kindle, 2020).
SEE MORE ESSAYS WRITTEN BY FRANK VISSER

THE CORONA CONSPIRACY
TABLE OF CONTENTS | REVIEWS

Reposted and expanded from Twitter, 3 November 2021

Thomas Cowan and the Spell of Corona

The Corona Conspiracy, Part 34

Frank Visser

It is only by misreading and strawmanning modern genomics that he, Lanka and Kaufman can pretend that these notions have some amount of credibility.

Last August, Tom Cowan has published a small booklet, Breaking the Spell, to change our opinion about virology[1]—which his previous book The Contagion Myth (see Part 19) apparently and to his dismay failed to accomplish. He also wants to answer some of the criticism he received, both from the side of science and that of the alternative areas:

Criticism of The Contagion Myth has come from many sources. Unsurprisingly, the 'scientific community'—conventional medical doctors and virologists—has expressed disagreement. Somewhat more unexpectedly has been the criticism that has come from those in the holistic health, anthroposophical and 'anti-vaxx' communities. This booklet, Breaking the Spell: The Scientific Evidence for Ending the Covid Delusion, is the best way I know how to respond to these varied critics.[2]

Responding to Various Critics

As a matter of fact, we have published two critical essays by Anthroposophist Richard Katz, one specifically related to Cowan's theories about COVID-19 and 5G, and one related to the Plandemic narrative, in which Cowan features as well. Katz was appreciative of the health recommendations Cowan makes, but opined that he undermines his case by various gross distortions of science. Not surprisingly, we will encounter the same pattern in Cowan's latest publication.

We may assume that this booklet contains Cowan's main argument related to COVID-19, so it enables us to review it more systematically than the occasional online video allows for. We have dealt with Cowan in Part 19, in which I demonstrated he was grossly misreading and misrepresenting scientific papers about the sequencing of SARS-CoV-2. When I sent him a link to this chapter he swiftly replied by email "There is nothing here to react to, just a list of the usual nonsense." This doesn't bode well for a reasonable discussion, but let's see how he responds to this review of his booklet.*

* Well, that was quick. When I posted a link to this chapter on his YouTube channel "Talkin' Turkey with Tom" it got deleted very quickly. ("Talking Turkey" is US slang for: discussing something honestly and directly).

On the promotional page of his booklet, Cowan confidently but prematurely asserts, referring to the yet unpublished research of Stefan Lanka (see Part 28 and Part 32):

Therefore, as of October 2021, it has now been proven that virology is based on false assumptions, SARS-CoV-2 or any other so-called pathogenic virus doesn't exist, and the entire Covid-19 narrative is bogus.[2]

This is virus denialism at its finest, so we will go into his argument step by step. Breaking the Spell contains the following 6 chapters:

  1. How does a virologist identify the existence of a new virus and prove that it causes disease?
  2. Modern "isolation" of SARS-CoV-2
  3. The PCR test
  4. The composition of the human being
  5. Why we get sick and what to do about it
  6. Practical steps to ensure health

This logically breaks down in two equal parts: what is the modern view of viruses, virus detection and viral disease? And if viruses don't exist, what makes people sick in this pandemic (what Cowan doesn't deny) and how do they get healthy again?

THE HISTORY OF VIRUS DETECTION

Pathogen detection methods have come of age. Here's an overview of the history of this field of science.[3]

Virus denialists typically harp back to virological textbooks of the early past century to make their point. They refuse to contemplate the advantages offered by modern day methods of pathogen detection. They are like old time sailors asking the captain of a container ship: "where's your sextant? I don't trust all this GPS stuff you are looking at. That's just digital fabrication!" Basically, that's the stance of Cowan and company.

Thomas Cowan
Thomas S. Cowan

So from the start Cowan goes down the by now familiar road of "disease is not necessarily caused by a virus" to "COVID-19 has many different symptoms" and from "there is no publication describing the isolation of this virus" to "dozens of governmental instituations and main authors of important scientific papers have actually conceded this" and from "viruses cannot be properly distinguished under a microscope from other cell particles" to "even with todays sophisticated methods this distinction is still not possible".

Then he starts to lecture the current virological community on how virus detection should actually be done: first an isolation of a pure virus, followed by photographic characterization and genome sequencing. Without that first step, the reasoning goes, how can we be certain that whatever gets sequenced is actually a new virus? This attitute towards the state of the art in virology cannot be described other than as freshman skepticism.

Next he attacks the notion of the "cytopathic effect" (CPE), which is assumed to be proof for the existence of a virus, by saying that it is not so much the virus (assuming it exists at all) that causes cells in a cell culture to die, but the conditions imposed on these cells by this very culture. In other words, mock-infected cultures used as controls in these experiments show exactly the same cytopathic effects (this is also the claim of Stefan Lanka, who Cowan follows closely here).

However, the internet is literally overflowing with photos of both mock-infected and infected viral cultures that show marked differences.[4] So either all the researchers of the world don't know how to mock-infect, or Stefan Lanka has fabricated his results to prove his claim.

In Chapter 2 he refers to the research of Stefan Lanka, who presumably has demonstrated (but not yet published in a peer-reviewed journal) that he can create the full SARS-CoV-2 genome using as source material uninfected samples to which yeast RNA has been added. In Cowan's version this becomes:

Knowing how the alignment process works, we can now understand what Dr. Lanka's fourth experiment actually showed. He was able to show that any RNA virus genome can be found in the results of the cell culture from the fourth experiment. Yet at no time were any of these viruses added or present in the experiment.

I have extensively argued in previous chapters that this is impossible even on purely theoretical grounds (see Part 26 and Part 28). Briefly, this amounts to saying: any book can be written with the same set of letters from the alphabet (or the same set of words from the dictionary). This is true, but trivial. In genome sequencing the units used to assemble a genome are more like whole sentences, which dramatically reduces this possibility. Nevertheless, Cowan concludes:

At this point, it should be clear that the existence of SARS-CoV-2 has never been scientifically proven. And because the virus has never been shown to exist, there is no way we can conclude that this virus causes any disease, has any "variants," contains any particular protein—in particular, the now famous spike protein—or has any other characteristics. (p. 14)

Recall how Andrew Kaufman explained away virus variants as "failures to reproduce the original index genome" of SARS-CoV-2 (see Part 31)? Then why do these variants typically spread through a population? Do all bio-informaticians all of a sudden make the same mistakes in a given area? And why can we point out why a given variant is more transmissible and/or lethal, by analyzing the effect of the mutations that causes them? Again, the virus hypothesis is the most plausible here.

PCR TEST TROUBLESHOOTING

Next he turns in Chapter 3 to the PCR test. Again, we encounter the familiar bits of misinformation. Cowan reports that Christian Drosten and his team created the first PCR protocol for SARS-CoV-2 "without having virus material available", but he fails to mention they had the full genome, sent by them from Chinese researchers. That is basically enough to create a proper test protocol. Of course, Kary Mullis is never far away, and Cowan repeats the blunder that Mullis never intended his PCR test to be used for diagnostic purposes. Yet, in the very patent Mullis filed for the PCR methodology it is explicitly stated that "various infectious diseases can be diagnosed... these include viruses... bacteria... and parasites" (see Part 1).

As to the alleged unspecificity of the Drosten PCR protocol, a lot of confusion has been generated by conspiracy theorists (see Part 20 and Part 24). Briefly, the test was deliberately set up to catch any of the SARS-related viruses, though it also contained a component testing specifically for SARS-CoV-2. Yet, this has been twisted to mean the test was "wholly unspecific" and could in fact not distinguish between SARS-CoV-2 and the common cold—even if during the validation of this protocol many respiratory viruses were used as control.

D-Salud logo

Getting more technical now, Cowan argues that it has been established that the primers used in the PCR test for SARS-CoV-2 could as well match with generic human or microbial DNA, leading to a great many false positives. To which the sober question can be raised: why is it that in some countries the percentage of positive test outcomes (not to mention false positives) basically dropped to zero for months (see Part 29)? What is more, he refers to a very dubious source to prove that the test matches dozens of microbes which are present in the databases used by virologists. Iain Davis reports in his article "COVID19—Evidence of Global Fraud", published in the conspiracy-friendly medium Off-Guardian of researches published in another sensationalist magazine, the Spanish D-Salud.[5]

Let's dive into this, because this is fun. Basically, the reasoning is that a primer sequence like this, which is part of the Spike (S) gene, can be found in the human genome as well:

TTGGCAAAATTCAAGACTCACTTTC

When I search for this nucleotide sequence in the so called BLAST database, limiting the search to the human genome, in a matter of minutes I indeed get many hits. But be careful, what does that mean?

Basic Local Alignment Search Tool

Basic Local Alignment Search Tool (BLAST)

First, the Spanish journalist writes "A human genome BLAST also finds a 100% sequence match to 86 human chromosome fragments." But if you look at the results, only 76% of this search string was found ("Query Cover"), even in the top rated hit.

The actual match found was (part of the search string colored red):

TTGGCAAAATTCAAGACTCACTTTC

So the original search string was not found (assuming that a search string of 25 characters is supported at all by this search engine).

The Spanish source also claims that he could find longer strings of SARS-CoV-2 in the human genome, like this part that occurs between a forward and reverse primer:

ATGAGCTTAGTCCTGTTGCACTACGACAGATG
TTGTGCCGGTACACAAACTGCTTGCACTGATGAC
AATGCGTTAGCTTACAACAACAAAGGGAG

However, when I tried to replicate this in the BLAST search engine, I got:

So much for independent investigative journalism by non-specialists...

Secondly, and much more relevant, it is eminently naive to just look up some primer sequence in the BLAST database, for the PCR protocol works much more complicated. It uses a "forward primer" (Fw), a "reverse primer" (Rv) and a "probe", to match and multiply the target sequences in the sample (see Part 15 about the Chromosome 8 canard). This of course greatly reduces the chance of a mismatch, mistaking a common piece of genetic material found in all humans for a new and dangerous virus. Yet, this is precisely the argument virus denialists tend to make.

Here's an example protocol from the Institut Pasteur in France:

Real-time RT-PCR assays for the detection of SARS-CoV-2 (Institut Pasteur, Paris)

Cowan also repeats the common conspiracy notion that governments can manipulate the percentage of positive PCR tests by fiddling with the number of cycles. More cycles, more positive tests. Less cycles, less positive tests. This is definitely not the case. The percentage of positive tests in a given country fluctuates dramatically, suggesting that the virus in the population waxes and wanes (see Part 29).

Tom Cowan clearly lives in a la-la-land of his own making.

Now, there is nothing wrong with leading a natural life and eating healthy food. But why would we have to deny most of modern medical and virological science for that?

Holistic or Integrative Health

Having eliminated the existence of viruses and hence the cause of the current pandemic, Cowan needs to become creative and present his alternative view of human health. He refers to maverick scientists Harold Hillman and Gilbert Ling, for "they are the two best biologists who have ever lived" (p. 25).

Following these two, Cowan denies most of modern cell theory and even denies the existence of ribosomes (where proteins are assembled). Let's go into more detail here. Proteins are long strings of amino-acid, which get assembled in the cell's ribosomes. Each amino-acid is coded in our DNA by a particular "codon" or string of three nucleotides (for example: GAC). Importantly, the information present in the nucleotide sequence is reflected in the amino-acid sequence. Amino-acids are strung together into proteins, which can get very long indeed.

Having denied the existence of ribosomes (Cowan, following Hillman, thinks that they are artifacts that only exist under a microscope) he asks us:

But the questions arise, "Where do the proteins come from? What is the impulse for their formation?" In answering these questions, we come to the essence of the split between the old versus the new biology. We also come to the essence of the "COVID" plot. (p. 32)

And it is here that Cowan becomes very creative indeed.

Veda Austin
Water researcher Veda Austin

Believe it or not, but he claims proteins are not coded by DNA, and manufactured in the cell's ribosomes, but are created by... water, which gets informed by "everything from chemicals, hormones, electromagnetic frequencies and toxins to thoughts and feelings." (p. 37). This "new biology of water", as he calls it, is inspired by a woman named Veda Austin, a New Zealand "water researcher", who, following the trail of Masaru Emoto, has demonstrated with many impressive photos that ordinary frozen water can pick up moods and remember highly specific information. Emoto became known through the New Age movie What the Bleep do we Know!?, in which he "demonstrated" that water can be influenced by thought (and even written messages written on bottle labels).

Austin takes this one step further, by placing a wedding invite on top of a petri disk filled with water, a wedding ring showed up when the water got frozen. Water even seemed to understand and appreciate famous art pieces!

Even if these "artistic experiments" by Austin are dubious in the extreme (and to my knowledge haven't been replicated yet), Cowan then jumps to a very bold conclusion:

The fact that the water created a wedding ring in Veda Austin's experiment gives us an idea of how the majority of proteins can be made without a genetic blueprint. The water is presented with an idea, a thought, an intention, or, in more scientific language, an aspect of consciousness. Through its living-crystal structure, the water senses this idea—this aspect of consciousness—and “collects” the free amino acids that are always dissolved in the cytoplasm of the cell or in the “body” of the watery syncytium. Using no blueprint other than water's remarkable ability to translate energy into matter, it creates this new protein to carry out its life tasks. (p. 33)

This mind-boggling style of argumentation defies even our wildest metaphysical dreams. How would "an idea, an intention, or, in more scientific language, an aspect of consciousness" know how to assemble a protein of, say, 2.000 amino-acids? Would it not be very handy to have at least the corresponding DNA sequence at hand? (just joking of course). Now that we are at it, let's take the spike protein of SARS-CoV-2, and even then only a small part of it, the receptor-binding domain (RBD):[6]

a, Overall topology of the SARS-CoV-2 spike monomer. FP, fusion peptide; HR1, heptad repeat 1; HR2, heptad repeat 2; IC, intracellular domain; NTD, N-terminal domain; SD1, subdomain 1; SD2, subdomain 2; TM, transmembrane region. b, Sequence and secondary structures of SARS-CoV-2 RBD. The RBM sequence is shown in red. c, Overall structure of the SARS-CoV-2 RBD bound to ACE2. ACE2 is shown in green. The SARS-CoV-2 RBD core is shown in cyan and RBM in red. Disulfide bonds in the SARS-CoV-2 RBD are shown as sticks and indicated by arrows. The N-terminal helix of ACE2 responsible for binding is labelled.

Compare this exquisitely precise scientific description with the hand-waving "consiousness or intention is behind it" utterances of our holistic virus denialists!

Based on all this colorful information, Cowan advises us to lead a natural life, connect with nature, avoid the virtual world, especially radiation, eat real food and drink water, when "structured", buy his many vitamin supplements and above all believe in a higher power. Now, there is nothing wrong with leading a natural life and eating healthy food. But why would we have to deny most of modern medical and virological science for that? That hardly seems to be holistic or integrative to me. This is health extremism erring to the other side.

The Secret Intelligence of Water | Veda Austin | WELL Community Gathering #2

Exploring Other Possible Causes

Cowan makes at least one reasonable statement in his booklet:

In the case of "COVID," I have no objection to exploring the hypothesis that some infectious agent is the cause of this potentially new illness, but I also contend that many other possible causes should be explored. (p. 2)

But then his line of reasoning becomes very crude indeed, arguing that a virus is not always the most plausible explanation:

[I]f the fact that a lot of people getting sick in the same place proves viral causation, then we could logically conclude that Hiroshima must have been a virus. If we claim that a disease that spreads is also proof of viral causation, then the Chernobyl disaster could have been caused by a virus. (p. 2)

Lucky for us, good old fashioned medical science already makes room for all the elements you need for an integral view of health: agent, environment and host.[7]

Infectious Agents, Hosts, and the Environment: Determinants of Disease Emergence and Persistence (Morens & Fauci, 2020).

Ironically, the book starts with a disclaimer: "The information contained herein should NOT be used as a substitute for the advice of an appropriately qualified and licensed physician..." Tom Cowan, remember, got his license revoked in December 2020.[8]

Disclaimer featured prominently in Tom Cowan's Breaking the Spell

In fact, most if not all licensed physicians will have a good laugh when they read about Tom Cowan's dopey medical theories. It is only by misreading and strawmanning modern genomics that he, Lanka and Kaufman can pretend that these notions have some amount of credibility.

NOTES

[1] Thomas C. Cowan, Breaking the Spell: The Scientific Evidence for Ending the Covid Delusion, self-published printed booklet and PDF, 43 pages, drtomcowan.com, August 2021.

[2] Tom Cowan, "My New Booklet Ends the Covid Delusion", drtomcowan.com, October 07, 2021.

[3] Mark Woolhouse et al., "Human viruses: discovery and emergence", Philos Trans R Soc Lond B Biol Sci. 2012 Oct 19; Cited in: Ian M. MacKay, "Sigh, yes, the 'COVID virus' is real", virologydownunder.com, October 6, 2020.

[4] Jeong-Min Kim et al., "Identification of Coronavirus Isolated from a Patient in Korea with COVID-19", Osong Public Health and Research Perspectives 2020; 11(1): 3-7. Cited in: Ian M. MacKay, "Sigh, yes, the 'COVID virus' is real", virologydownunder.com, October 6, 2020.

[5] Jesús García Blanca, "La Estafa Ha Sido Confirmada: La PCR No Detecta El SARS-CoV-2, Sino Secuencias De Genes Endógenos", dsalud.com, November 2020; English translation: "The scam has been confirmed: PCR does not detect SARS-CoV-2, but endogenous gene sequences", telegra.ph, Februari 2021; Cited in: Davis I. "COVID19—Evidence of Global Fraud", off-guardian.org, November 17, 2020.

[6] Jun Lan et al., "Structure of the SARS-CoV-2 spike receptor-binding domain bound to the ACE2 recept", Nature, 30 March 2020.

[7] Morens, D.M. & Fauci, S.A., "Emerging Pandemic Diseases: How We Got to COVID-19", Cell, Volume 182, Issue 5, 3 September 2020, Pages 1077-1092.

[8] Barbara Feder Ostrov, "Conspiracy theory doctor surrenders medical license", calmatters.org, Feb. 5, 2021, Updated Sep. 28, 2021.

Check out: 27 Covid-19 Myths &
83 Vaccine Myths from docbastard.net
To all those who claim SARS-CoV-2—or any virus—does not exist: the virosphere consists of 7 realms 11 kingdoms, 22 phyla, 4 subphyla, 49 classes, 93 orders, 12 suborders, 368 families, 213 subfamilies, 3,769 genera, 86 subgenera, 16,215 species. Take that. https://talk.ictvonline.org/taxonomy/

A summary of early parts of this series has appeared in the Dutch magazine Skepter 33(3), September 2020, as "Viruses don't exist" (covering Parts 1-5). German: Skeptiker (December 2020); English: Skeptic.org.uk (January 2021)



PLEASE NOTE: Comments containing links are not allowed, to avoid spam.


Widget is loading comments...