Check out 1.000 AI-generated essays on integral philosophy

Check out AI-generated critical reviews of all Wilber's books

TRANSLATE THIS ARTICLE
Integral World: Exploring Theories of Everything
An independent forum for a critical discussion of the integral philosophy of Ken Wilber
Ken Wilber: Thought as Passion, SUNY 2003Frank Visser, graduated as a psychologist of culture and religion, founded IntegralWorld in 1997. He worked as production manager for various publishing houses and as service manager for various internet companies and lives in Amsterdam. Books: Ken Wilber: Thought as Passion (SUNY, 2003), and The Corona Conspiracy: Combatting Disinformation about the Coronavirus (Kindle, 2020).
SEE MORE ESSAYS WRITTEN BY FRANK VISSER

THE CORONA CONSPIRACY
TABLE OF CONTENTS | REVIEWS

Corona, Oxygen, 5G:
The Paranoid Worldview of David Icke

The Corona Conspiracy, Part 1

Frank Visser

‘The only reason that this connection between 5G and Corona cannot be talked about, is that there is such a connection!’
— David Icke

With every news channel overflowing with news about the coronavirus, the more disturbing items are about the disinformation spread about its cause and nature. David Icke, a former keeper, sports-journalist and world-famous conspiracy-theorist, has recently been interviewed by Brian Rose for the internet talk show "London Real", which was aired on London Live and attracted 65.000 viewers.[1] On YouTube, it was viewed by hundreds of thousands—until it was taken down. The official reason: medical information contradicting the WHO guidelines will be banned. And Icke implied that 5G towers need to be set on fire. Of course, true to his conspirational spirit, Icke interpreted this as evidence for the points he is making: the establishment (among which Google, which owns YouTube) and the elites (Icke's favorite enemy) don't want you to know the truth of what is happening. His own YouTube channel has had 103,860,439 views as of today. So there is a huge audience for this material.

The Coronavirus Conspiracy: How COVID-19 Will Seize Your Rights & Destroy Our Economy (banned from YouTube, reposted on Bitchute)

‘There is no COVID-19. It doesn't exist.’

In the interview, Icke claims—among many other things—that there is a connection between the COVID-19 symptoms and 5G, the fast-internet platform soon to be rolled out in many countries, and already operative in some others, including China. He states: "With 5G life as we know it will be over." How so? ‘There is no COVID-19. It doesn't exist.’ Huh? Tests for the presence of the virus are nonsensical, because "everybody will test positive", since it tests for general genetic material everybody has. And the real disease is caused by so-called "exosomes", particles expelled from cells due to radiation damage. And here does 5G come in: 5G is creating the "disease" that is misdiagnosed as COVID-19. Some daring doctors speak out on this now. What was the first Chinese city that got 5G? Wuhan! See the connection? People dying from COVID-19 are actually dying from lack of Oxygen. And here's the connection: 5G can block the capacity of the lungs to absorb Oxygen. The frequency used by 5G, 60GHz, is also the frequency at which Oxygen molecules resonate.

But this connection cannot be talked about. And the only reason that this connection between 5G and Corona cannot be talked about, says Icke, is that there is such a connection!

The interview goes on and on but this is already more than I can handle. So this new coronavirus, does it actually exist? You bet. The whole thing got sequenced in a matter of days.

SARS-CoV-2 belongs to the broad family of viruses known as coronaviruses. It is a positive-sense single-stranded RNA (+ssRNA) virus, with a single linear RNA segment. Other coronaviruses are capable of causing illnesses ranging from the common cold to more severe diseases such as Middle East respiratory syndrome (MERS). It is the seventh known coronavirus to infect people, after 229E, NL63, OC43, HKU1, MERS-CoV, and the original SARS-CoV.
Like the SARS-related coronavirus strain implicated in the 2003 SARS outbreak, SARS-CoV-2 is a member of the subgenus Sarbecovirus (beta-CoV lineage B).[63][64] Its RNA sequence is approximately 30,000 bases in length.[7] SARS-CoV-2 is unique among known betacoronaviruses in its incorporation of a polybasic cleavage site, a characteristic known to increase pathogenicity and transmissibility in other viruses.[44][65][66]
With a sufficient number of sequenced genomes, it is possible to reconstruct a phylogenetic tree of the mutation history of a family of viruses. By 12 January 2020, five genomes of SARS-CoV-2 had been isolated from Wuhan and reported by the Chinese Center for Disease Control and Prevention (CCDC) and other institutions;[7][67] the number of genomes increased to 42 by 30 January 2020.[68] A phylogenetic analysis of those samples showed they were "highly related with at most seven mutations relative to a common ancestor", implying that the first human infection occurred in November or December 2019.[68] As of 27 March 2020, 1,495 SARS-CoV-2 genomes sampled on six continents were publicly available.[69] (Wikipedia).

As of June 2020, the number of sequenced genomes has grown to 4,496! These different strains are virtually identical, except for minor variations due to mutations that have occurred since January 2020. This is an impressive feat of science, that measurement and visualization of this virus' full genome has become possible in such a short time span. Here's a fantastic real time display of the SARS-CoV-2 virus strains that have been detected worldwide, with all their micro-evolutionary variations:

Genomic epidemiology of novel coronavirus - Global subsampling (Nextstrain.org).

Compare this to David Icke's amateuristic analysis of the earliest medical investigations in Wuhan:

People started getting ill for whatever reason in China. And the Chinese authorities took genetic material from the fluid in the lungs of people who got ill, only a few, a very small number. And they found what they—what we would call "genetic material". It wasn't an isolated virus. It was genetic material, which can be there from a long list of causes, including lung cancer, by the way. And they decided that what was causing the illness was a virus, which has got the name "COVID-19" [no, it is Sars-CoV-2]. But at no time did they isolate that so-called virus from the rest of the genetic material, much of which will be found in the bodies of most people. [05:05]

Never mind that COVID-19 is the disease and the virus is called SARS-CoV-2... He wants us to believe that the "genetic material" sampled from the first victims was gathered randomly and amplified, until it "proved" the existence of a new virus. In reality, based on the symptons, these early researchers suspected a variant of the 2002 SARS virus, of which the full genome was known. That proved to be correct.

But Icke can't have a virus as cause of the symptoms, for he needs to tell his G5 story...

Andrew Kaufman
Andrew Kaufman: ‘I think I
know what is really going on.’

There have always been researchers who denied AIDS was caused by the HIV virus (Lynn Margulis was one of them). Likewise, Andrew Kaufman, a psychiatrist(!) quoted by Icke, explains "COVID-19" symptions not by the Sars-CoV-2 virus, but by some other mechanism. Where's the scientific publication about this alternative theory? I could only find Kaufman's YouTube channel, which has only a handful of videos, about health food, detox, blood pressure, "Do viruses cause disease?" and—a rather strange title—"Humanity is NOT a virus!". The YouTube title of this video is "Is COVID-19 really an exosome and not a virus???" (note again the inexplicable confusion between the disease, and the virus). Kaufman has also been interviewed by London Real now, and you can see that video on London Real TV.

Andrew Kaufman, "Is COVID-19 really an exosome and not a virus???"

Kaufman has discovered similarities between the coronavirus and so-called "exosomes", particles a cell produces normally that serve for communication and waste disposal. Under a microscope they look similar to virus particles. Exosomes and viruses share the same ACE2-receptor, which has a function related to blood pressure regulation. Ergo: they might very well be the same thing, says Kaufman. So the whole medical profession battling COVID-19 at the moment has just mistaken one little blob for another little blob? Seriously? Says a psychiatrist, not a virologist.

In support of this hypothesis, Kaufman states, quoting AIDS researcher James Hildreth, "the virus is fully an exosome in every sense of the word" (incidentally, this quote was about HIV, not the SARS-CoV-2 virus). So? Can one catch an infectious disease through these exosomes? Is Kaufman denying the new coronavirus, or even all viruses? Exosomes can be produced, says Kaufman, under stress, toxins, injury, cancer, infection, ionizing and electromagnetic radiation like 5G... He could not find any evidence(!) for this last category, but he suggests this would be an exciting new field of study...

There goes Icke's major support for his 5G/Corona theory!

No evidence for the relation of 5G and Corona
From Kaufman's presentation on the many causes of illness—no evidence for 5G.

He advises: hydroxylchloroquine and Vitamin C, because of its anti-oxydant properties—the usual alt-medicine advice. But no, "there's no evidence for a virus." Read that last sentence very closely.

DEBUNKING BOTH ICKE AND KAUFMAN

Now I have a question for you: is it likely that a psychiatrist communicating in a YouTube video with a handful of anonymous persons has a better understanding of the virological aspects of SARS-CoV-2 than the thousands of specialists working in this particular very specalized field of science? How small would you estimate that chance? So it's time now to turn to those specialists (though I haven't found any public response to Kaufman yet from the medical establishment).

This is obviously a very specialized area of expertise—neither Icke nor you and me are qualified here. But researching this topic online I found the following three YouTube videos by an anonymous poster "Another Perspective" very helpful. Please watch these videos to follow the author's argument. I have highlighted a few conclusions in the tables below.

Video #1: David Icke is WRONG about COVID-19

Here's a refutation of Icke's statement that "the coronavirus doesn't exist" and "has never been isolated":

A debunking of Icke's claim that COVID-19 (the SARS-Cov-2 virus) does not exist.

CLAIM BY ICKE REFUTATION
#1 - There is no evidence that's scientifically produced that COVID-19 exists. The SARS-CoV-2 virus that causes COVID-19 has been fully sequenced.
#2 - RT-qPCR cannot distinguish between viral and human genetic material. RT-qPCR can distinguish between viral and human genetic material.

Summing up: the SARS-Cov-2 virus has not only been isolated—2685 samples no less!—but also fully sequenced (all 30.000 nucleotide bases: A, C, G or T), and identified as being a member of the larger coronavirus family (Order: Nidovirales).

Just for the fun of it, here's a fragment of the fully sequenced genome of SARS-Cov-2:

a fragment of the full sequenced genome of SARS-Cov-2
A fragment of the fully sequenced genome of SARS-Cov-2 (ncbi.nlm.nih.gov)

The author gives a nice example of how specific and precise DNA matching can be. If you enter this snippet of SARS-CoV-2 DNA (containing only 28 of the 30.000 nucleotides, or less than 0.1%) into the so called Blast search engine of the US National Library of Medicine:

CCGTCTGCGGTATGTGGAAAGGTTATGG

... within a few seconds you get ONLY hits from this particular virus RNA—no other material, as is suggested falsely by Icke.

Search for viral DNA of SARS-CoV-2
Search results for a snippet of viral DNA of SARS-CoV-2 in the Blast search engine.

And here you can see where that search string can be found in the total genome of SARS-CoV-2:

Search results for a snippet of viral DNA of SARS-CoV-2 in the total genome.

This should put to rest all talk about "random genetic material" falsely claimed to be a virus. We know the SARS-CoV-2 virus down to the very base-pair code.

Video #2: Andrew Kaufman is WRONG about COVID-19

And here's a devastating critique, by the same author, of Kaufman's arguments related to "exosomes as viruses". He's just wrong:

A debunking of Kaufman's "a virus equals an exosome" theory.

CLAIM BY KAUFMAN REFUTATION
#1 - Respiratory illness is caused by an insult, toxic or otherwise, which cause production of exosomes. Exosomes are small membrane vesicles of endocytotic origin that are secreted by most cells in culture.
#2 - RT-PCR actually tests for host RNA from exosomes. RT-PCR tests are SARS-CoV-2 specific, they do not confuse it with RNA from exosomes.
#3 - Exosomes are mistaken for COVID-19 [SARS-CoV-2], they look very much the same. Exosomes and the SARS-CoV-2 virus look very different under the microscope (spikes!).

Summing up: viruses are not exosomes (though there are interesting similarities between them), but can exploit exosome pathways to leave the cell they have infected. Totally different story—and much more interesting. There is no need whatsoever to deny the existence of viruses at any cost. For one thing: viruses reproduce, exosomes don't. All coronaviruses have spikes; exosomes don't. There is some debate about the viral origin of exosomes: perhaps viral DNA, which contains genes for building vesicles with RNA, got permanently inserted into the host genome in the past. That is something for real scientists to figure about and debate.

Video #3: Andrew Kaufman is WRONG about COVID-19 - Part 2

And here's another, equally devastating critique, by the same author, of Kaufman's arguments related to the work of Kary Mullis and James Hildreth.

A debunking of Kaufman's misinterpretation of Kary Mullis and James Hildreth.

CLAIM BY KAUFMAN REFUTATION
#1 - PCR cannot be used to diagnose infectious diseases, according to Kary Mullis PCR can be used to diagnose infectious diseases, even according to Kary Mullis
#2 - No scientist can tell the difference between exosomes and viruses (quoting Hildreth). Scientists, like Hildreth, can clearly tell the difference between exosomes and viruses.

Summing up: Kaufman misrepresents scientific information to fit his theories. He thinks the viruses observed through microscopes are actually exosomes, and he tries to find support for this opinion by quoting from respected scientists who don't share his views and misrepresenting them in the process. And he casts undue doubt on the quality of PCR tests for detecting specific viral material—spuriously misquoting its Nobel Prize winning inventor.

Kary B. Mullis, Work - An organism's genome is stored inside DNA molecules, but analyzing this genetic information requires quite a large amount of DNA. In 1985, Kary Mullis invented the process known as polymerase chain reaction (PCR), in which a small amount of DNA can be copied in large quantities over a short period of time. By applying heat, the DNA molecule's two strands are separated and the DNA building blocks that have been added are bonded to each strand. With the help of the enzyme DNA polymerase, new DNA chains are formed and the process can then be repeated. PCR has been of major importance in both medical research and forensic science. (www.nobelprize.org, The Nobel Prize in Chemistry 1993)

Here's the original patent of the PCR technique filed by Kary Mullis: Process for amplifying, detecting, and/or cloning nucleic acid sequences, on June 17, 1987 (Date of patent: Oct. 23, 1999).

Field of the invention. The present invention relates to a process for amplifying existing nucleic acid sequences if they are present in a test sample and detecting them if present by using a probe. More specifically, it relates to a process for producing any particular nucleic acid sequence from a given sequence of DNA or RNA in amounts which are large compared to the amount initially present so as to facilitate detection of the sequences, using a thermostable enzyme to catalyze the reaction. The DNA or RNA may be single- or double-stranded, and may be a relatively pure species or a component of a mixture of nucleic acids. The process of the invention utilizes a repetitive reaction to accomplish the amplification of the desired nucleic acid sequence. (Underline added)

Oh, and what about the virologist Hildreth who supposedly is on board with Kaufman's views? Hildreth is just representing the conventional understanding of viruses: they definitely exist! He warns us to be vigilant about not spreading the infection ourselves here:


Hildreth: 'Be vigilant, don't
become a vector of COVID-19.'
Viruses are incomplete life forms with no ability to replicate on their own, so they must find a way to gain entry into the cells in our bodies, explained Dr. Hildreth.
Many viruses need hosts before they can get into humans, and those hosts are called vectors, he said.
“In 2002, the hosts were cats. Then for MERS, the host was camels,” Dr. Hildreth stated. “So, efforts were made to eradicate the vectors. But what happens when the host is human? The difference with COVID-19 is that we are the vectors. It’s able to jump from human to human. So, our challenge is to eradicate the vector. That’s why we’re asking you to don’t become a vector of COVID-19. You don’t become a vector by staying at home, practicing social distancing, and sanitizing surfaces often,” he said. (Amsterdamnews.com, 4/5/2020)

See Part 2, in which I contact Hildreth about him being quoted by Kaufman on the matter of viruses being exosomes, and this is his response: "The virus is real. The pandemic is real and is caused by the virus. Period."

So Kaufman's view sounds a lot like the germ theory denialism for disease to me, with the germ being a virus, which is often found in the more radical anti-vaccine communities. So no harmful virus exists, but patients are "hurt" by something, and that could point to various causes.

WHERE DOES 5G ACTUALLY FIT IN?

Most likely candidate for Icke: 5G.

That should be easy to test, when the occurence of COVID-19 is mapped with the spread of 5G networks. It doesn't bear out: there were initially lots of areas with G5 that didn't have infections, and lots of areas without 5G that had them.

So, onto 5G. The electromagnetic spectrum has multple bands, including those of visible light. The longer wavelengths, those on the "infra-red end" of the spectrum (to which 5G and all radio-waves belong) are non-ionizing, i.e. they can't break molecules. Those on the "ultra-violet end" of the spectrum (to which gamma rays belong) are ionizing, i.e. they can change molecules and thus do damage. For that reason 5G is harmless.

How dangerous is 5G?
How dangerous is 5G? Can it harm your health? No, it is non-ionizing radiation.

The supposed connection between 5G and the COVID-19 disease works through Oxygen? Well, there is some truth to the fact that the 5G frequency most used, 60GHz, happens to be the frequency at which Oxygen absorbs part of this radiation. But look carefully: it is not so much that Oxygen is hindered by 5G, for it is exactly the other way round: 5G is hindered by Oxygen! What happens here is the Oxygen molecules briefly enter an excited state, before they resume their normal state, and disperse the radiation in all directions, thus impacting the transmission (but not always negatively).[2] It resembles how your microwave works: at the frequency of the radiation used in microwaves, the water molecules in your food absorb some of this radiation so the food is heated.

And what about the 5G rollout in Wuhan? Was that really the first Chinese city where 5G was installed? By October 2019 in fifty Chinese cities, including Beijing, Shanghai, Guangzhou and Shenzhen, 5G was rolled out and fully operational.[3] Where's their coronavirus? It is plainly ridiculous to even suggest such a correlation—let alone a causal connection. (Less extreme conspirationists claim 5G only left the inhabitants of Wuhan more vulnerable to the—in itself real—coronavirus. On what evidence?).

For Icke 5G is part of a worldwide attempt to spy on us and to enslave us—and to kill more and more people. Even the vaccines that will be invented to combat Corona will contain nanotechnology microchips, he fears. This is a thoroughly paranoid atmosphere we are presented with. With that mindset it is understandable he sees setting fire to 5G masts as a good thing... Healthy suspicion, OK, but this is extreme.

Making sense(?) of the conspiracy views on 5G and the coronavirus
Making sense(?) of the conspiracy views on 5G and the coronavirus

Trying to make sense of the conspiracy views linking the coronavirus to 5G, which is by no means easy: there seem to be two views. The "health concern" view claims that 5G weakens our immune system, so we are more susceptible to any viruses that happen to be around (as in Wuhan). The "paranoid conspiracy" view of David Icke bypasses the need for a virus and claims 5G prevents the uptake of Oxygen, which causes severe lung problems. None of these views is supported by evidence, since the spread of 5G doesn't match the incidence of COVID-19 infections (and where it does, like in large cities, more down to earth explanations are possible, such as high population density).

The pinnacle of paranoia is Icke's suggestion that, since the number of COVID-19 deaths is much lower than predicted, 5G masts are built near hospitals as much as possible to kill more and more people—who have died of the so-called coronavirus.

A Hierarchy of Evil Beings

Icke, Everything You Need to Know But Have Never Been Told
Icke: ‘Our simulated reality is the
work of a highly negative force.’

This quasi-religious worldview of enslavement and liberation, fear and love, shows affinity with a certain historical worldview that is worth going into. In his recent book Everything You Need to Know But Have Never Been Told (2017) Icke gives some glimpses into this worldview. It turns out he is a modern-day gnostic, when he extensively quotes form the Nag Hammadi Library, a collection of early Christian and Gnostic texts discovered near the Upper Egyptian town of Nag Hammadi in 1945. The Christian gnostics (there were many others) were a group of sects who believed the Jewish God was not the highest Power but one of the lesser gods, and not a very exalted one at that. In the Old Testament he indeed comes across as rather jealous and vengeful. This lesser God the Greeks called the "Demiurge", which is not the Almighty Creator. In this cosmology, there is a whole hierarchy of beings, from the lowest Satan, the Prince of this World, and his angels to Sophia in the spiritual world and the Pleroma above it. (See table 1).

Icke shows affinity with this worldview: "I have been convinced long before I saw the Nag Hammadi texts that our simulated reality is the work of a highly negative force and this is what the Gnostics go on to describe." In his universe, the world is under the spell of evil influences, which feed on hatred, violence and anger. Hence they are keen to provoke wars and disaster in every possible way. From the two World Wars to 9/11, Icke sees the hand of this hierarchy of evil beings, often called by him "the Illuminati" or "Lucifer". According to him, their work includes the foundation of the United Nations, which aims at a New World Order, and every attempt to come to a World Government. The end goals of these beings, he feels, is to enslave humanity. The only way out of this, he concludes, is to lead a life of love and awareness, which makes one invulnerable against these influences.

Table 1 - The Gnostic-Ickian Cosmology
Pleroma

GODHEAD/PLEROMA/TOTALITY/FULLNESS
SOPHIA
‘Imbalanced Thought’
Demiurge

DEMIURGE/JEHOVA/YAHWEH/YALDABAOTH
ARCHITECT/SAMAEL/SATAN/LUCIFER/DECEIVER
‘Different names, same force.’
ANGELS/ARCHONS/DEMONS/CYBORGS/VAMPIRE GODS

Against this particular intepretation of the Demiurge by the Christian gnostics the Greek philosopher Plotinus would later write his famous "Against those that Affirm the Creator of the Kosmos and the Kosmos Itself to be Evil", or "Against the Gnostics" for short. Here's a quote:

Moreover it is wrong to assume an evil origin and evil being (to kakos gegonenai) of this world, because of all the difficulties in it. This is rather the expectation of those who believe this world must be as perfect as the intelligible when it is merely its image. And if we look around, we must admit that there could be no fire, no earth, no celestial dome and no sun better than those of our world, other than their intelligible counterparts. This world is as perfect as a corporeal world can be. (Plotinus, Against the Gnostics, Enneads II.9, Ch. 4)

Ken Wilber discusses this topic in Sex, Ecology, Spirituality (1995) in the paragraph "Plotinus's Attack on the Gnostics" (p. 341-344). "Plotinus was uncompromising with those who wanted to glorify either this world or the other world—they were both missing the point entirely." In the terminology of Wilber, these Gnostics were "Ascenders", who viewed all manifestation as nothing but shadows, and evil shadows at that. The so-called "Descenders" recognized only the visible, tangible world. A more nondual view sees all aspects of reality as infused with divinity, even if in different layers of intensity. Wilber sees Plotinus as the "luminous beacon" in the West of this balanced approach.[4]

This explains why Icke's focus is on wars, disharmony and manipulation, where Wilber's focus is on development and evolution. Wilber's metaphysics is different: he sees Spirit as descending to the lowest level of matter, after which it returns back and upwards towards the spiritual realms. He sees the phenomena of evolution as such as "evidence for Spirit".[5] It is all a matter of emphasis. One can justify any metaphysics by pointing to things happening in the real world, both positive and negative. Icke's selection of events comes across as rather paranoid—behind the scenes, they are out to get you.

Some aspects of Icke's worldview border on the ridiculous—and here are the Reptilians:

The Draco constellation
Icke's "reptoid hypothesis" posits that humanity
is ruled by descendants of reptilians from Draco.
Icke believes that the universe is made up of "vibrational" energy and consists of an infinite number of dimensions that share the same space. He advocates the existence of an inter-dimensional race of reptilian beings called the Archons (or Anunnaki) who have hijacked the earth and that a genetically modified human-Archon hybrid race of shape-shifting reptilians known as the Babylonian Brotherhood, the Illuminati, or the "elite", manipulate global events to keep humans in constant fear so the Archons can feed off the "negative energy" this creates.
He claims many prominent public figures belong to the Babylonian Brotherhood and are propelling humanity toward an Orwellian global fascist state, or New World Order, a post-truth era where freedom of speech is ended. Icke believes that the only way this 'Archontic' influence can be defeated is if people wake up to the truth and fill their hearts with love. (Wikipedia)

One wonders, if Icke is really exposing the powers of evil at such a grand scale, wouldn't they come to get him? To end on a lighter note: If it turns out that Reptilian Overlords are behind the scene of all earthly events—why hasn't anybody worried about the Amphibians?

The Brotherhood which controls the world today is the modern expression of the Babylonian Brotherhood of reptile-Aryan priests and 'royalty' which came together there after the flood. It was in Babylon in this post-flood period from around 6,000 years ago that the foundation beliefs - manipulated beliefs - of today's world religions were established to control and rule the people. (David Icke, The Biggest Secret, 1999)

NOTES

[1] "David Icke, The Coronavirus Conspiracy: How COVID-19 Will Seize Your Rights & Destroy Our Economy, www.londonreal.tv, April 7, 2020 , 2:33:28. This page has over 8.000 comments. The video can be watched on www.bitchute.com. Full transcript.

[2] "Fixed Wireless Communications at 60GHz Unique Oxygen Absorption Properties", www.rfglobalnet.com, April 10, 2001. "Due to the high levels of atmospheric RF energy absorption, the millimeter wave region of the RF spectrum is not usable in long haul, wireless communications segments. However, for short haul, "last mile" segments, the expanded RF data bandwidth available in the millimeter wave region makes it ideal for interference free, fiber speed connectivity."

[3] "China Focus: Top mobile operators switch on commercial 5G services", www.xinhuanet.com, October 31, 2019. "The 5G commercial services are now available in 50 cities, including Beijing, Shanghai, Guangzhou and Shenzhen. Shanghai had activated 11,859 5G base stations by mid-October, which will support the 5G network coverage across the city's key outdoor areas, said the municipal administration of communications Thursday."

[4] For a critique of Wilber's take on Plotinus see: Brian Hines, "What Wilber gets wrong about Plotinus", www.integralworld.net, November 2009. Hines states Plato or Plotinus were Ascenders, and less nondual than Wilber wants us to believe.

[5] Ken Wilber, The Religion of Tomorrow, Shambhala, 2017.

…the "creative advance into novelty" that is demonstrated by evolution itself … is inexplicable by mere "chance mutation" (the evolution from strings to quarks to subatomic particles to atoms to small molecules to massively interconnected molecules to asexual cells and early organisms—just for starters—is an awful lot of evolution in a universe that is supposed to be "running down" but can easily be seen as yet more evidence of creative Eros or Spirit-in-action, "a self-organizing self-transcendent drive," as Erich Jantsch put it)… (p. 498)

FURTHER READING

INITIAL SCIENCE REPORTS

"Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome", NCBI, GenBank: MN908947.3, 18-MAR-2020.

Zhu N et. al., "A Novel Coronavirus from Patients with Pneumonia in China, 2019", Pub Med, www.ncbi.nlm.nih.gov, N (The New England Journal of Medicine., 2020 Feb 20).

Jeong-Min Kim et. al., "Identification of Coronavirus Isolated from a Patient in Korea with COVID-19", Osong Public Health Res Perspectv.11(1); 2020 FebPMC7045880.

Victor M Corman et. al., "Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR", PMC, www.ncbi.nlm.nih.gov, (Euro Surveillance, 2020 Jan 23).

POPULAR SCIENCE

"What does 5G have to do with coronavirus? Where did it come from? Your questions answered", dw.com (a German media organization Deutsche Welle).

Nicole Jawerth, "How is the COVID-19 Virus Detected using Real Time RT-PCR?", www.iaea.org, March 27, 2020.

"Report of the WHO-China Joint Mission on Coronavirus Disease 2019 (COVID-19)", WHO, 16-24 February 2020.

Ethan Siegel, "The Science Of Why 5G Is (Almost) Certainly Safe For Humans", www.forbes.com, Nov 1, 2019.

"2019-20 COVID-19 outbreak", rationalwiki.org

SOCIO-CULTURAL

Jules Evans, "'Conspirituality': the overlap between the New Age and conspiracy beliefs", medium.com, April 17, 2020.

Jaron Harambam & Stef Aupers, "From the unbelievable to the undeniable: Epistemological pluralism, or how conspiracy theorists legitimate their extraordinary truth claims", journals.sagepub.com, December 17, 2019.

NEWS ABOUT ICKE

Leo Kelion, "Coronavirus: YouTube tightens rules after David Icke 5G interview", www.bbc.com, 7 April 2020.

Check out: 27 Covid-19 Myths &
83 Vaccine Myths from docbastard.net
To all those who claim SARS-CoV-2—or any virus—does not exist: the virosphere consists of 7 realms 11 kingdoms, 22 phyla, 4 subphyla, 49 classes, 93 orders, 12 suborders, 368 families, 213 subfamilies, 3,769 genera, 86 subgenera, 16,215 species. Take that. https://talk.ictvonline.org/taxonomy/

A summary of early parts of this series has appeared in the Dutch magazine Skepter 33(3), September 2020, as "Viruses don't exist" (covering Parts 1-5). German: Skeptiker (December 2020); English: Skeptic.org.uk (January 2021)




PLEASE NOTE: Comments containing links are not allowed, to avoid spam.


Widget is loading comments...