TRANSLATE THIS ARTICLE
Integral World: Exploring Theories of Everything
An independent forum for a critical discussion of the integral philosophy of Ken Wilber
Ken Wilber: Thought as Passion, SUNY 2003Frank Visser, graduated as a psychologist of culture and religion, founded IntegralWorld in 1997. He worked as production manager for various publishing houses and as service manager for various internet companies and lives in Amsterdam. Books: Ken Wilber: Thought as Passion (SUNY, 2003), and The Corona Conspiracy: Combatting Disinformation about the Coronavirus (Kindle, 2020).
SEE MORE ESSAYS WRITTEN BY FRANK VISSER

THE CORONA CONSPIRACY
TABLE OF CONTENTS | REVIEWS

Reposted and expanded from Twitter, 16 May 2021

Promotional banner of the COVID-19 Myths fundraising webinar.
Promotional banner of the "COVID-19 Myths" fundraising webinar.

Twitter Review of the “COVID-19 Myths” Webinar

The Corona Conspiracy, Part 26

Frank Visser

So these two gentlemen are happy to jump on any bandwagon that supposedly provides proof for their conviction that neither viruses nor contagion do exist.

In a fundraising webinar[1] Andrew "no virus" Kaufman and Tom "no contagion" Cowan—who feature prominently in my book THE CORONA CONSPIRACY—presented their views on the pandemic to a group of true believers, and some fence-sitters, in an attempt to cover for their expenses. Meet the fringe of the fringe.

They covered three topics: pathogenic priming (Cowan), genome sequencing (Kaufman) and new genetic vaccines (Kaufman). I will focus on sequencing, because that is really where the evidence lies for the existence of viruses.

Fun fact: the webinar started about 45 minutes later than planned, because of a Denial of Service attack on the servers of the company providing the webinar. This only fuelled the paranoid feelings of the virus-denying audience, as proof that mainstream science is desperate!

I watched the webinar, paid the $20 fee, and it was worth it—especially when unexpectedly the discussion following the three presentations turned into a direction wholly unanticipated by the two famous speakers. More on this below.

Virus Isolation Revisited

In the past year the public debate in the media on COVID-19 has been dominated by two voices. The dominant view sees SARS-CoV-2 as a dangerous virus that asks for drastic measures. A vocal minority view feels the virus is not that harmful after all.

Both camps, however, believe that there really is a virus to begin with. Enter the world of virus denialism, where the very existence of viruses is called into question. This eccentric view does not get much media coverage much to the chagrin of its main heroes and followers. They suspect this vocal minority is controlled opposition.

Their main tenet is that SARS-CoV-2 "has never been isolated", adhering to a dictionary definition of isolation which no modern virologist will subscribe to. And since it doesn't exist, they claim, it doesn't cause disease, nor can it be tested for or sequenced or monitored. None so blind as those who will not see.

In particular, they want their virus to be "purified" and "isolated", not just cultured in cells (as you know, viruses only grow in cells), as virologists tend to do. But wait, the Oxford Dictionary of English sees precisely that as a legitimate meaning of "isolate":

The dictionary meaning of "isolate" supports modern virology (source).

Dictionary meanings aside, it takes a massive data blindness to deny the existence of by now 1,5 million full or partial genomes of SARS-CoV-2, which have been submitted to the GISAID database. That exquisite photos have been taken of this virus, down to the molecular level of detail, is lost on them.

But, you may ask to them, why have three million people died in this pandemic, and hundreds of million people been infected, if there is no virus? That, they claim without the blink of an eye, is something that still has to be "investigated", preferably in a "really scientific" manner. Apparently, they don't see this as their task.


Structure of the SARS-CoV-2
spike glycoprotein (closed state)

Dismissing the great accomplishments of modern digital virology, they claim to have superior knowledge and insight into "what is really going on", often taking a deep dive into conspiracy, frequently bordering on the paranoid. For these people, it really is a matter of "us" vs. "them", truth seekers vs. the scientific establishment.

So Andrew Kaufman can come up with literary gems such as "something that doesn't exist cannot be sequenced" or "something that doesn't exist cannot be the cause of a disease." These people verily live in a bygone age. It is much like insisting on Newton in an age of Einstein and quantum physics.

Kaufman presented his uninformed understanding of whole genome sequencing, claiming that all viral genomes are arbitrary and randomly "stitched together", overlooking the fact that these genomes have a definite structure, and consist of several protein components, each with its own unique function.

And what about the many "variants" we hear of these days? In Kaufman's universe these are just "failed attempts to reproduce the original reference genome." Never mind that these variants typically arise in one location and often rapidly spread to other regions, countries or even continents. Exactly what you would expect with a contagious virus! Look at the Indian variant B.1.617.2 as it spreads now in the UK:

"Coronavirus variant gaining ground in England, data show".
(Source: Financial Times, May 17, 2021)

Undaunted by their lack of empirical data, they point to virus denialist Stefan Lanka, who recently announced that he has empirical proof that the so-called cytopathic effect (CPE) is an artifact of laboratory conditions, and in no way a proof of the existence of viruses.

STEFAN LANKA'S MAGIC TRICKS

What is more, Stefan Lanka has also claimed evidence that viral genomes are arbitrary constructions without connection to real viruses, by assembling any viral genome (HIV, Ebola, SARS-CoV-2—you name it) from a random set of RNA, extracted from a healthy cell culture.

We are eagerly awaiting Stefan Lanka's publications. To be sure, it is high time he comes up with empirical evidence for his rather outlandish notions about viruses, or rather their non-existence, and his magical genomic tricks really would make headline news—if true (see Part 7).

In the video "7 Ways to Prove that Viruses do not Exist", posted on the conspiracy channel Bitchute, Lanka already announces his expected results, in a conversation with Cowan. Let's follow his reasoning to see if it makes any sense at all. My guess is that it is doomed from the start, for reasons I will explain.

Stefan Lanka
Stefan Lanka: “And as soon as I get hold of original sequence data which was produced for HIV, I am going to produce you coronavirus. Definitely! And this is going to be the definitively experimental disproval of virology.”
Lanka: Point 5. In order to build a genome of a virus... when there is, oh, a new virus, in Wuhan... you always need a different genome as a point of orientation. Where to add the smaller pieces. Where to fit them into the genome. So, it would be like a sentence out of the Bible, or 30.000 letters, right? And we need small letter combinations of 1, 2, 3, 4, 5 letters, and try to fit them to the place where they fit, right?
And, no control experiment, again. And the control experiment would be, to try to get the alignment of another RNA virus. It could be the measles virus, Ebola virus, the HIV virus. That would be the control experiment: let's try if we can fabricate another one!
Cowan: In other words, you can take the same raw dataset, the same set of short pieces of RNA in the mixture, and then you can create, you can find the template for the coronavirus, a template for the HIV virus, and then you tell the computer to orient it, or align it to that template, and in each case it will. And it will tell: yes, this person has measles, this person has HIV, this person has Ebola, this person has Zika, and by the way, this person has the coronavirus...
Lanka: That's it! And I am now on my way to find an old dataset of the measles virus, or of HIV, right? And as soon as I get hold of original sequence data which was produced for HIV, I am going to produce you coronavirus. (smiles triumphantly)
Cowan: [inaudible]
Lanka: Definitely! And this is going to be the definitively experimental disproval of virology. But until we have this, the argument, on its own, is enough. We are looking for these smaller sequences to fit into the larger sequence, right? This larger sequence never, ever, came out of a biological unit, it is itself a fabricated thing, right? Virology does not have a viral genome, and everything it does to do an alignment, is fabricated.
Cowan: That's what we call an in silico genome of an in silico virus.
Lanka: That's it, that's it... (7:30-11.00)

No, this argument, on its own, is not enough. Not even close. And one does wonder, why would Lanka need an original data set of the HIV virus, if viruses don't exist in the first place? Why not take a healthy sample and "fabricate" any viral genome you like from it? That would be a good way to prove his point. Here's why that would fail.

This comes across as stupid to me as saying: hey, I can write any book using the same letters of the alphabet! There are no books! Or, I can even write any book using the same dictionary! There are no books! It is all fabricated! Of course, this is cheating. Genomics doesn't work like this. The small RNA segments or reads are much longer than words, and therefore more unique. So the proper claim would be: I can write any book by using the sentences, or even strings of sentences, from any other book!

No, you can't Stefan Lanka. You don't even have to try it. Never mind that the HIV virus is only 10.000 bases, compared to the 30.000 of SARS-CoV-2. It is the uniqueness of the strings of bases that will prohibit such an excercise. And more importantly, not all sequencing is template-based, as Lanka claims. This needs some further explanation, which we will cover in the next section.

In an article written for his own magazine WissenschaftPlus (4, 2020), Stefan Lanka outlined seven arguments that supposedly refute virology (in a slightly different ordering). The first three exhibit his complete lack of expertise in modern day sequencing:

Stefan Lanka's "refutation" of modern virology
ARGUMENT OBJECTION
1. Virologists have never isolated a complete genetic strand of a virus, only very short pieces of nucleic acids, which they assemble in a ficticious long genome strand with the help of complex computational and statistical methods (alignment). This is like saying: Mars explorers have never taken a complete picture of the Martian landscape, only smaller pictures that are combined in a larger one. That is just part of the method. It doesn't make the end result "fictitious".
2. They have never done this alignment with control material, following the exact same procedure (except for the presence of a virus). Any sample can be sequenced these days, with or without virus, to determine which organisms live in it (fungi, bacteria, human cells, etc.). This is called metagenomics.
3. To make this alignment, virologists need a template of another virus, which is also just a mental construct. This is only true for template based sequencing (see below). There are other, more advanced sequencing techniques.
4. Viruses have never been seen in a human/animal/plant or in liquids thereof. See below
5. The composition of the structures that are claimed to be viruses has never been biochemically characterized. See below
6. Electon microscopic images are known typical artifacts or cell specific structures. See below
7. Animal experiments refute the virus-existence assertions, because their results are produced by the method itself. A great read on the intricacies of animal experiments can be found in "Animal models for COVID-19" (Nature, September 2020)

The title of this article is quite revealing of his agenda: "Virologists who claim disease-causing viruses are science fraudsters and must be prosecuted"...

Believe it or not, Stefan Lanka denies the existence of viruses, which he re-interprets as (unspecified) human cell particles. As a consequence, in his understanding, PCR tests don't detect viruses, but these very same particles. Viral genomes are arbitrary constructions, again, based on human genes. Hence there are so many false positives, he claims.[1a] Except that this is not at all the pattern we see over the months the pandemic has raged on. The percentage of postive tests rises and falls with the waxing and waning of the pandemic in a certain region. New variants spread when they are more contagious, and can even cross country borders. Variants can be traced genetically to the very base detail. Instead of random noise, we see meaningful signals. All this is completely inexplicable within the there-is-no-virus model.

SHREDDING THE VIRAL GENOME

Kaufman also brings up the metaphor of shredding a book into pieces, followed by its reconstruction (see also Part 6). But he misses a crucial point about this metaphor. In his presentation, he gives the impression that sequencing is like trying to fit together books that have been shredded into thousands of fragments.

Andrew Kaufman, "COVID-19 Myths" webinar handout, slide 33.[1]

He implies, basically, that sequencing is a hopeless task, completely random and arbitrary. But the really interesting thing about this metaphor is that sequencing is like the shredding of multiple copies of the same book (analogous to having RNA from multiple copies of the same virus). With only one copy of a shredded book, it is very hard to determine which fragment fits together with which other fragment. But with multiple copies, similar fragments from the same page will not be cut precisely in the same way, which enables fragments from different copies to overlap eachother. This way, words can form sentences, and sentences can form whole pages.

Obviously, it takes a computer to figure out all these relationships between millions of RNA fragments, and that is exactly the huge advance modern virology has made in the past decades. That doesn't make the viral genome a fabrication or construction devoid of any relationship with the real world—as is consistently claimed by virus denialists like Kaufman and Cowan—or something "merely" digital or in silico. Far from it! RNA is extracted from real samples, and digitized without information loss so the fragments or "reads" can be re-assembled into the whole and complete genome.

Furthermore, Kaufman tried to discredit viral genome sequencing by giving a misleading example where short words in a sentence lead to ambiguities because they occur in two different sentences. But the example is a bit disingenious: "struck at" might occur in several sentences, but what about "symptoms struck at" or "struck at nine"? No chance. So? Genomics is a tad more sophisticated. (See again Part 6)

Andrew Kaufman, COVID-19 Myths presentation, slide 34
Andrew Kaufman, "COVID-19 Myths" webinar handout, slide 34.[1]

How frequently do sequences occur actually in viral genomes and do they make an unambiguous genome impossible? It all depends on the length of the sequence. The longer the sequence, the less it is likely you will find it in some other location of the same genome. I did a quick frequency count in the official SARS-CoV-2 genome (Wuhan-HU-1) by taking a random sequence fragment out of the total of 30.000 bases of which the SARS-CoV-2 genome consists, for example: ACTCCGTGGAGGAG.

Fragment of the genome of SARS-CoV-2.

Now, how unique is that particular fragment? And if we make it smaller and smaller? Let's start with the smallest option: one base only, in this case the A. It occurs 8954 times. (Notably the frequencies of A and T roughly match, as do those of C and G).

BASE FREQUENCY
A 8.954 (30%)
T 9.594 (32%)
C 5.492 (18%)
G 5.863 (20%)
TOTAL: 29.903 (100%)
Frequency of single bases in the SARS-CoV-2 genome.

Strings of more than one base will be less and less frequent, as you will understand. When is the "level of uniqueness" (red) reached? Much sooner than you think.

NUMBER OF BASES FREQUENCY
A 8.954
AC 1.999
ACT 666
ACTC 94
ACTCC 11
ACTCCG 2
ACTCCGT 1
ACTCCGTG 1
ACTCCGTGG 1
ACTCCGTGGA 1
ACTCCGTGGAG 1
ACTCCGTGGAGG 1
ACTCCGTGGAGGA 1
ACTCCGTGGAGGAG 1
Varying base sequence frequency in SARS-CoV-2.

As you can see, in this example, uniqueness sets in even after six bases! And even a string of merely six bases occurs only twice. All sequences longer than that occur only once in the SARS-CoV-2 genome as a whole. (Of course, I might have picked a rather unique sequence for this quick test, but you get the idea). And when complete genomes are assembled from smaller "reads" or fragments, these contain much more bases than half a dozen.

With reference to Lanka's bold claim that he can assemble the SARS-CoV-2 genome from any set of bases, it is instructive to compare the genomes of SARS-CoV-2 and HIV for any mutual sequences. Do these genomes have anything in common? The length of matching sequence snippets is usually 6-10 bases long, as I found out by a few random searches. Not more. That is a very relevant discovery.

A bit of information theory. Computers work with bits, which can have the value 1 or 0. It takes 8 bits or one byte to define 256 different bit sequences. With four bases (A, C, T, G), living organisms have a far richer language. They can reach that number 256 already with 4 bases. You get the following possible combinations:

NUMBER OF BASES COMBINATIONS
A 41 = 4
AC 42 = 16
ACT 43 = 64
ACTT 44 = 256
ACTTA 45 = 1024
ACTTAC 46 = 4.096
ACTTACA 47 = 16.384
ACTTACAC 48 = 65.536

While base sequences might not be purely random (some might be more likely than others), this number makes sense given the length of the two viral genomes (HIV: 11.000 vs.SARS-CoV-2: 30.000). Let's say that above the length of 10 bases, the number of possible combinations is so huge that it is unlike you will find a match between these genomes. Put differently: I never found a match of 12 bases from the HIV genome when I searched for it in the SARS-CoV-2 genome.

Comparing genomes of highly related viruses, say SARS-CoV-2 (NC_045512.2) and RaTG13 (MN996532.1), the length of the matching sequences is of course much and much longer. Here you have an example of 33 consecutive bases matching:

Do you see now how superficial Lanka's understanding of modern day genome sequencing is?

In order to build a genome of a virus... when there is, oh, a new virus, in Wuhan... you always need a different genome as a point of orientation. Where to add the smaller pieces. Where to fit them into the genome. So, it would be like a sentence out of the Bible, or 30.000 letters, right? And we need small letter combinations of 1, 2, 3, 4, 5 letters, and try to fit them to the place where they fit, right?

No, Lanka's project will only work when he uses tiny pieces of the genomic puzzle, of at most a dozen bases long, which is a very unrealistic scenario! It is precisely the long and unique string of bases that identifies a certain virus, as much as it is a long and unique string of letters that identifies a sentence.

Can you find the sentence "Call me Ishmael", the famous opening line of Moby Dick, in any other original book? No, you cannot (see Part 28).

And finally, if you compare the full genomes of HIV (NC_001802.1) and SARS-CoV-2 (NC_045512.2), you will see the match is very imperfect indeed:

Comparing the genomes of HIV and SARS-CoV-2: no overlap in sight.

As I predicted above, only SARS-CoV-2 reads up to six nucleotides can be found in another genome, such as HIV. Reads longer than this are simply unique for this specific virus.

Three Ways of sequencing

There are roughly two standard ways to assemble a full genome: with the help of a "reference genome" or template, or completely from scratch ("de novo"). In both cases the uniqueness of sequences is a great help, as you can see below. These three short reads match the template (in red) only in these unique locations.

TEMPLATE BASED GENOME SEQUENCING
ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGA

   AAAGGTTTATAC     CAGGTAA      AACCAACTTTCGA
Viral RNA fragments match with the template (in red).

Alternatively, by having multiple copies of the same virus available, and cutting their RNA in different reads, the full genome can be assembled by the fact that reads from different virus copies show substantial overlap. Again, the uniqueness of these overlapping sequences guarantees a unique genome, for there is no other way it would fit.

DE NOVO GENOME SEQUENCING
   AAAGGTTT                                   

     AGGTTTATACC                              

          TATACCTTCCCAGGTA                    

                    CAGGTAACAAACCAACCAA       
ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGA
Viral genome is assembled (red) from overlapping fragments.

Without this overlap, and without a template as guide, we would never know that AAA is followed by GGT, but now we do.

Kaufman is not aware of all these subtleties and often claims you can only build a viral genome if you already have a template available. Nor is he aware of even more sophisticated forms such as nanopore sequencing (which sequences viral RNA in one stretch, not in thousands of fragments), as he admitted during the webinar. When a skeptic participant mentioned it, he promised he would get back to us on this...

NANOPORE GENOME SEQUENCING
ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGA

ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGA
Viral genome is reconstructed (red) from long string of bases.

Virus denialists usually are dramatically uninformed about these advanced technologies (see Part 25, in which virus denialist and self-reported Nobel Prize candidate Stefano Scoglio, co-author of Virus Mania, gives his opinion about that latest technology). Kevin McKernan, co-author of the infamous Corman-Drosten Review Report (see Part 20 and Part 24) sees nanopore sequencing technology as state-of-the-art. To all virus denialists he has the following clear message:

That's why I said, we are dealing here with the fringe of the fringe...

SMACK RIGHT IN THEIR FACE

Slices through tomographic reconstructions of SARS-CoV-2 virions
Slices through tomographic reconstructions of SARS-CoV-2 virions.[2]

Highlight of the webinar session was when Kaufman an Cowan were suddenly confronted during Q&A by a skeptical guy who shared his screen showing one of the most stunning types of photography (cryo-EM) ever made of this SARS-CoV-2 virus.[2] They were not aware of the paper and would get back to us. Really? We’ll see.

True virus denialists (such as Lanka, Kaufman, Cowan, Bailey, Scoglio, Eckert and others) typically have knee-jerk responses such as: must be exosomes! This can be anything (as long as it is not a virus)! As for their own "theories", they invariably have no empirical leg to stand on.

Kaufman taken off-guard by critics
Kaufman caught off-guard by a critic.

Thomas Baldwin, who presented them with empirical evidence, argued that multiple lines of evidence proved the existence of viruses: the proteins are predicted by the genome, it produces a specific type of amino-acid sequence that we can visualize with this cryo-EM, and also detect on a Western blot [a laboratory method to detect proteins], which detects the protein sequence. Kaufman replied he needed to see the methods section of that paper, and Baldwin immediately complied. He stated that, in contrast to Kaufman's opinion, the authors had used a sucrose gradient [a lab technique for characterization or preparation of subcellular particles] to extract the virus, and cultivated it in several rounds to observe the cell damage. Cowan interrupted by asking "but was it taken directly from a human being?", to which Baldwin answered: yes, and then it was cultured, but why does that matter? He also countered Cowan's suggestion that a toxin might be involved, causing the cell damage, by explaining that during these rounds of cell culture, a toxin would get diluted, whereas a replicating virus will grow in number.

These virus denialists often try one last escape route: the burden of proof is not on them, but on scientists to really be... eh scientific. So non-scientists telling practicing scientists how to do their work. Interesting. Or should we say: deranged and dangerous nonsense? The whole "the virus has not been isolated" trope is lacking empirical support. If their claim is that the viral genomes reconstructed (not "fabricated") by science might as well be derived from human genetic material, where's the evidence for that?

Remember the hysteria around chromosome-8, picked up and amplified by Icke and Kaufman, as I described in Part 15? And mind you, this only related to a small viral RNA sequence that might be identical to an equivalent small human sequence. Except that it wasn't. These matters can easily be verified (and refuted) by doing a simple BLAST search—something neither Kaufman nor Cowan seem to be aware of.

The Basic Local Alignment Search Tool (BLAST) finds regions of local similarity between sequences. The program compares nucleotide or protein sequences to sequence databases and calculates the statistical significance of matches. BLAST can be used to infer functional and evolutionary relationships between sequences as well as help identify members of gene families. (https://blast.ncbi.nlm.nih.gov)

Tom Cowan too has his way of conveniently twisting scientific data. In an earlier video he (falsely) argued this virus can’t even infect human cells, this time he and Kaufman report Lanka’s spurious claim that CPE’s always occur due to lab conditions (See Part 19). You can't have it both ways. The truth is that infection by a virus happens only with certain types of cells (with the right receptors).

So these two gentlemen are happy to jump on any bandwagon that supposedly provides proof for their conviction that neither viruses nor contagion do exist. Quote mining and misrepresenting real experts (e.g. James Hildreth, see Part 2).

They have their own Covid-19 myths, for sure.

In the meantime, have a look at this splendid animation, based on real cryo-EM pictures of SARS-CoV-2:

Cryo electron tomography of SarS-CoV-2. A representative cropped tomogram is shown as constitutive slices along the z-axis. [2, Supplementary materials]

APPENDIX 1: DAN WILSON'S VIDEO REVIEW

Here's a 10-minute razor sharp review of the "COVID-19 Myths" webinar, done by Dan Wilson (of the Debunk the Funk YouTube channel), who also watched and recorded the webinar. In this episode he highlights how Kaufman and Cowan were taken completely by surprise during the Q&A session, by a science colleague who presented these two with a wealth of evidence for the existence of the virus:

"I just wanted to share that with you guys to show you what happens when you confront these agents of misinformation with questions from actual scientists."

Here are some key arguments of this video:

CLAIMS BY KAUFMAN COMMENTS BY WILSON
The virus is actually an exosome [Puzzled look on Dan's face]
Nobody has ever purified the virus That absolutely has been done.
If it is purified after cell culture that is no good. This is complete nonsense to anybody who works with cell culture and viruses.
The virus should be taken directly from a human sample. That would contain much more contamination than a pure cell culture.
The EM photos show no viral particles, because they were treated with heavy metals. This is not how cryo-EM works. That would be negative-stain electron-microscopy.
These are not viral particles that are shown of the pictures. So what are these particles according to your model?

In his video, Wilson extends an invitation to Kaufman and Cown to discuss these papers in more detail (as Kaufman promised he would):

I do hope doctors Kaufman and Cowan keep to their word and read the paper that we showed them and address it and the invitation is totally open for them to talk about it with me and my colleague live. They can take us up on this offer or they can continue to have their webinars in their little echo chamber where they charge twenty dollars a pop to people who want to show up. And in this webinar over 800 people showed up. When people ask me why would these people lie, well there's a possible answer..
Anyway, I just wanted to share that with you guys to show you what happens when you confront these agents of misinformation with questions from actual scientists.

APPENDIX 1a: ANDREW KAUFMAN'S REPLY

Dr. Andy and Dr. Tom straighten all things virological out for us...

Several days after the webinar, Kaufman has posted a "bonus video" on his website (available only to webinar participants) responding to our concerns. As announced, he had consulted the Methods and Materials paragraph hidden in the Supplementary Materials section of the paper[2], and just repeated his arguments that the source material for both sequencing and cryo-EM photography ("MUC-1", which was received from a German colleague) did not consist of purified virus taken directly from a patient (or at least, from the documentation provided in the paper that could not be ascertained). But typically, these SARS-CoV-2 isolates are freely available to registered researchers at sites such as BEI Resources):

Severe acute respiratory syndrome-related coronavirus 2 (SARS-CoV-2), isolate Germany/BavPat1/2020 (also referred to as Germany/MUC-IMB1/2020 or Human/DEU/BavPat1-ChVir929/2020) was isolated from a sputum sample from a mildly symptomatic adult male patient identified as Patient One in the Bavarian cluster on January 28, 2020 in Bavaria, Germany.[4] (emphasis added)

The discussion about the meaning of "isolated" will not end any time soon in these conspiracy circles.

Now, there is a difference between rational suspicion and irrational suspicion, and Kaufman's version definitely belongs to the latter category. So this whole paper, published in Science, detailing several converging lines of evidence, is a fabrication and we have no ways to validate that it deals with a real virus? Irrational skepticism will ask: how do we know that this Bavarian patient had this virus? All the way back to the first genome assembled by Chinese researchers: how do we know this genome refers to a new virus? Because that particular genome was assembled de novo, from scratch, using the latest technologies: next-generation meta-transcriptomic sequencing.[1b]

Andrew Kaufman replies to Dan Wilson
“This is an excellent point...”

Kaufman's reply boils down to: "how do we know that these genomes refer to this particular virus and not to human genetic material? How do we know that the virus visible in the cryo-EM is the SARS-CoV-2 virus and not some other virus or cell particle present in the sample? Even virologists admit they can't tell the difference between viruses and exosomes." At the end of the day, that is all they can come up with. Smug superiority is Andrew Kaufman's middle name.

In my opinion, it is only by a massive data-blindness that the exquisitely detailed information in this paper can be pushed aside that lightly. It almost seems to me to be a new neurological affliction rampant in these circles of virus denialism, a psychogenic blindness for widely established facts. But, as always, virus denialists have their own alternative facts (see Part 5). Unfortunately, as I said above, they seldom or never use the tools we have at our disposal these days to prove that viral genomes can actually be found in our human genome, or in that of fungi or bacteria for that matter. They just throw up their hands and exclaim: "this could be anything!" when confronted with scientific evidence—and continue to sell their expensive potions to the gullible.

WILSON AND BALDWIN RESPOND

Dan WilsonThomas Baldwin

After the bonus video was posted by Kaufman, Wilson invited him by email to have a dialogue about these matters, but got no response. Since Kaufman did not get back to Wilson, and by not engaging with Wilson and Baldwin directly, he most probably wants to avoid to be embarrassed again in front of his own faithful audience.

Dan Wilson and Thomas Baldwin have therefore now posted a 1,5 hour video reflection on Kaufman's bonus video, underlining his compete lack of expertise when it comes to modern day genomic technology and cryogenic electron microscopy. He is shown to be only superficially aware—if at all—of the various modern sequencing technologies such as nanopore sequencing (remember how Stefano Scoglio badly fumbled that topic in Part 25 as well?) and standard laboratory practice in general.

Two scientists dismantle Andrew Kaufman's ridiculous COVID claims.

Here are a few highlights from their commentary:

POINTS RAISED BY KAUFMAN WILSON AND BALDWIN
Nanopore sequencing was used in this paper No, nanopore sequencing was just mentioned in passing
cry-EM technology, I guess, combines EM and computerized tomograpy cryo-EM technology, developed in the 70, has been greatly refined in recent years.
The paper is only a mere 6 pages long That's only normal for a Science paper
The methods section is hidden behind a link That's only normal for a Science paper
The MUC-1 sample used is unreferenced MUC-1 samples are standard practice
How can you separate human and viral material? That is routinely done with modern technologies
Centrifugation method uses is not good enough Centrifugation method used is good enough
The reference genome is a bat SARS corona virus BetaCoV/Germany/ BavPat1/2020 is from a patient from Bavaria
How do you know these are not exosomes? Viruses and exosomes behave very differently.
How do you know this is SARS-CoV-2 and not some other virus in the mix of cultured cells? They may look much alike, but viral genomes are very specific, thus they can never be confused
Why hasn't the Isolate Truth Fund Prize been collected? No amount of evidence will convince a virus denialist
I don't need to have a theory, I am just criticizing virology Kaufman/Cowan don't have a falsibiable theory of their own.

WILSON AND BALDWIN CONTINUE

In their comments during the webinar Baldwin asked Kaufman: if the spikes you see in these EM-photos are not spikes from viruses, where do they come from? Though Kaufman did not reply directly to either Wilson or Baldwin, he seems to have come up with an answer to this question in another webinar.[2a] So-called viral spikes might as well be engineered in gain-of-function research and would best be understood as "synthetic exosomes". Here is a commentary on that "hypothesis" from our critics:

Two scientists take Andrew Kaufman back to school.

Here are a few highlights from their commentary:

POINTS RAISED BY KAUFMAN WILSON AND BALDWIN
There are far less genes then proteins Alternative splicing solves that problem
Vaccines use human genetic material packaged in envelopes. An envelop, a plasmid, lipids used in mRNA—all very different things
Viral particles present in vaccines are actually synthetic exosomes. If these spike proteins have a human origin, why not prove it?
The spike protein is dangerously similar to Syncytin-1, a protein used to build the placenta. The similarity isn't even close (MUSCLE), so there is no danger at all for pregnant women.[2b]
The spike protein might have been manufactured through gain-of-function research. There are way too many differences in these two sequences, as a basic alignment demonstrates.
The spike protein can be produced by the human genome itself, it does not have to have a viral origin. There is nothing in the human genome that can produce this particular spike protein (proves this with a BLAST search).
Vaccines are produced only to poison people. Why would anybody ever want to do that??
Big Bad Pharma is only creating vaccines to make profit. If they don't make a good product, nobody will buy it.

Appendix 2: More images of SARS-CoV-2 virions

Here's another paper with exquisite photography of the SARS-CoV-2 virus and its components.[3] The abstract gives you a flavor of the level of empirical detail that is involved in these studies:

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) virions are surrounded by a lipid bilayer from which spike (S) protein trimers protrude. Heavily glycosylated S trimers bind the ACE2 receptor and mediate entry of virions into target cells. S exhibits extensive conformational flexibility: it modulates the exposure of its receptor binding site and later undergoes complete structural rearrangement to drive fusion of viral and cellular membranes. The structures and conformations of soluble, overexpressed, purified S proteins have been studied in detail using cryo-electron microscopy. The structure and distribution of S on the virion surface, however, has not been characterised. Here we applied cryo-electron microscopy and tomography to image intact SARS-CoV-2 virions, determining the high-resolution structure, conformational flexibility and distributions of S trimers in situ on the virion surface. These results provide a basis for understanding the conformations of S present on the virion, and for studying their interactions with neutralizing antibodies.

Characterization of virus production and representative images of intact, authentic SARS-CoV-2 virions
Characterization of virus production and representative images of intact, authentic SARS-CoV-2 virions. (A) Western blot analysis of SARS-CoV-2 S and N in lysates of VeroE6 cells and in virus preparations. In released virions, S is present in both cleaved and uncleaved forms. (B) Four representative tomographic slices of SARS-CoV-2 virions from the supernatant of infected cells. Virions are approximately spherical, contain granular density corresponding to N-packaged genome, and have S protein trimers protruding at variable angles from their surfaces. Scale bar 50 nm. (C) Three example S trimers from the dataset shown as projections through the trimer to illustrate the variable tilt towards the membrane. Scale bar 10 nm.[3]

Note: this second study used the same virus isolate: Germany/BavPat1/2020.

Appendix 3: COVID-19 Myths Part 2

COVID-19 Myths Part 2 webinar
covid-19-myths.com

Kaufman and Cowan have announced a second installment of the COVID-19 Myths webinar, to be held on July 17th, 2021. The announcement reads:

We will EXPOSE the PSEUDOSCIENCE on: VIRUS MIMICKERS - the misnomer of viral cultures based upon identical known biological samples, MAGNETISM - as related to the true circulatory system of the body and the interference of MAGNETIC NANOTECHNOLOGY, and the mystery of the SPIKE PROTIEN - its origin and its function.

I very much doubt if it is worth another $20, but we'll see if this offers us more delicious food for skeptical thought. It looks very much like a carnival in no-virus land.

In the meantime, Part 3 and Part 4 have also been released by Kaufman & Cown.

NOTES

[1] "COVID 19 MYTHS: Pathogenic Priming, Genome Sequencing and the New Genetic Vaccines", andrewkaufmanmd.com, May 15th, 2021. Kaufman's Powerpoint presentation can be found here: "Is there really a novel coronavirus?", www.ukcolumn.org

[1a] Stefan Lanka, "The virus misconception: measles as an example", wissenschafftplus.de, nr. 1, 2020.

[1b] Yong-Zhen Zhang and Edward C. Holmes, "A Genomic Perspective on the Origin and Emergence of SARS-CoV-2", www.cell.com, April 16, 2020.

[2] Beata Turonová, et al., "In situ structural analysis of SARS-CoV-2 spike reveals flexibility mediated by three hinges", Science, 09 Oct 2020.

[2a] Science and Medicine Panel with Drs. Andrew Kaufman and Saeed Qureshi, June 2021.

[2b] "Debunked: No, Pfizer's head of research did not say the Covid vaccine is 'female sterilisation'", www.thejournal.ie, Dec 10th 2020.

Dervila Keane, a Pfizer spokeswoman, said there is “no data to suggest that the Pfizer/BioNTech vaccine candidate causes infertility”.
“It has been incorrectly suggested that Covid-19 vaccines will cause infertility because of a very short amino acid sequence in the spike protein of SARS-CoV-2 virus that is shared with the placental protein, syncytin-1.
“The sequence, however, is too short—four shared amino acids—to plausibly give rise to autoimmunity. Additionally, a cohort comparing the outcomes of pregnancies with and without intercurrent SARS-CoV-2 infection shows no difference in outcomes,” Keane said.

[3] Ke, Z., Oton, J., Qu, K. et al. "Structures and distributions of SARS-CoV-2 spike proteins on intact virions", Nature 17 August 2020.

[4] "NR-52370 SARS-Related Coronavirus 2, Isolate Germany/BavPat1/2020 (Viruses)", www.beiresources.org

Check out: 27 Covid-19 Myths &
83 Vaccine Myths from docbastard.net
To all those who claim SARS-CoV-2—or any virus—does not exist: the virosphere consists of 7 realms 11 kingdoms, 22 phyla, 4 subphyla, 49 classes, 93 orders, 12 suborders, 368 families, 213 subfamilies, 3,769 genera, 86 subgenera, 16,215 species. Take that. https://talk.ictvonline.org/taxonomy/

A summary of early parts of this series has appeared in the Dutch magazine Skepter 33(3), September 2020, as "Viruses don't exist" (covering Parts 1-5). German: Skeptiker (December 2020); English: Skeptic.org.uk (January 2021)






PLEASE NOTE: Comments containing links are not allowed, to avoid spam.


Widget is loading comments...